Application Of A Neutral Community Model To Assess -Books Download

Application of a Neutral Community Model To Assess
31 Dec 2019 | 34 views | 0 downloads | 9 Pages | 1.25 MB

Share Pdf : Application Of A Neutral Community Model To Assess

Download and Preview : Application Of A Neutral Community Model To Assess


Report CopyRight/DMCA Form For : Application Of A Neutral Community Model To Assess



Transcription

Venkataraman et al, FIG 1 A Anatomical connections between the lungs stomach and oral and nasal cavities permit movement of microbes between these sites B Implemen. tation of a neutral model for analysis of microbial community structure The solid black line represents the best fit neutral model generated using a probability. distribution Dashed lines represent 95 confidence intervals around this best fit neutral model Species within the confidence intervals gray points are likely. present in the lungs because of neutral processes i e dispersal from the source community and ecological drift within the lungs Species deviating from the. neutral model green and red points either are candidates for selection in the lungs or differ in their ability to disperse compared to other microbes in the source. itors for the local environment In other words there is an equal the source community is used to calculate the probability of de. opportunity for all microbes to i disperse from the surrounding tecting that OTU in the lungs because of dispersal and ecological. environment ii grow in the local environment and iii be lost drift Very simply high abundance of a species in the source leads. or removed from the local environment The processes of stochas to a high probability of dispersal and low abundance in the source. tic birth and loss of microbes in the local environment are referred leads to a low probability of dispersal Fig 1B With this ap. to as ecological drift Therefore processes with unbiased or neu proach we show that the composition of the healthy lung micro. tral outcomes shape the presence and relative abundance of mi biome is entirely consistent with neutral distribution of microbes. crobes in the local environment from one or more sites in the oral cavity No species were identi. Processes with both selective and neutral outcomes are typi fied that consistently deviated from model predictions suggesting. cally present and invariably influence the composition of micro that constant microbial dispersal overrides selection in shaping. bial communities in diverse habitats including marine sediments the composition of the healthy lung microbiome We suggest that. freshwater hot springs plant and animal hosts wastewater treat lack of selection in a healthy lung is biologically relevant since. ment plants and bioreactors 11 17 Delineation of the contri microbiomes in diseased lungs are associated strongly with in. butions of selection and neutral processes provides a broad insight creased selection of specific microbes. into mechanisms generating and maintaining community com. position This goal can be accomplished by using a mathematical RESULTS. implementation of the neutral community model to test the cen Composition of the healthy lung microbiome is consistent with. tral postulate of the neutral biodiversity theory stated above 18 neutral distribution of microbes from the oral cavity We deter. 21 Species consistent with the model predictions are likely de mined the identity of microbes in bronchoalveolar lavage BAL. tected in the local environment due to dispersal from the specimens from 62 healthy volunteers 24 through molecular. surrounding environment ecological drift or both 21 23 Spe surveys of 16S rRNA encoding genes While traditional nonpara. cies deviating from the model are either the strongest candidates metric analyses suggest that there is little difference between the. undergoing selection both positive and negative by the local lung and oral wash communities Bray Curtis analysis of similar. environment or have different dispersibility relative to other mi ity ANOSIM R 0 11 p 0 02 they do not address the ques. crobes in the surrounding environment tion Can we distinguish between species that are detected in the. Accordingly here we consider several body sites including the lungs because of neutral processes and those that are adapted for. tonsils and throat that are potential sources for the lung micro growth in the lungs To answer this question we applied the. biome and use a neutral community model adapted from Sloan neutral model of community ecology to the lung microbiome. et al 18 to ask if neutral processes from these sites are sufficient The neutral model assumes that the composition of communities. to explain the observed composition of the lung microbiome The can be explained by dispersal of species from the surroundings. relative abundance of an operational taxonomic unit OTU in and ecological drift within that community 19 22 We consid. mbio asm org January February 2015 Volume 6 Issue 1 e02284 14. The Lung Microbiome, ered different body sites as potential sources for the lung micro. biome Each body site was considered separately as a potential. source community First with a goodness of fit test R2 we de. termined how well the neutral model explained the overall com. position of the lung microbiome with each of these source body. sites An R2 value closer to 1 implies that the composition of the. lung microbiome is consistent with neutral processes of dispersal. and ecological drift Since the neutral model employs a nonlinear. mathematical function in cases when it does not adequately de. scribe the community composition R2 can be 0 25 For the. same reason the value of R2 cannot be interpreted as the percent. age of variance in the observed detection frequencies explained by. the neutral model Next OTUs from the lungs were identified that. were consistent with predictions of the neutral model based upon. their abundance in the source body site These OTUs are termed. neutrally distributed i e consistent with dispersal and ecolog. ical drift Finally OTUs that deviate from the model predictions. are identified as the strongest candidates undergoing selection in. The neutral model can be applied only to OTUs that are shared. between a source body site and the lungs A majority 99 3 of. sequences recovered from all lung samples fall into OTUs that are. shared with other body sites The remaining 0 7 of sequences. unique to the lung are detected sporadically i e in less than 15. of the samples and at very low relative abundance in each sample. Since the lungs are a dynamic environment in constant interaction. with other body sites we think it likely that sequences unique to. the lung are a result of sampling stochasticity rather than consti. tuting a core healthy lung microbiome, The composition of the healthy lung microbiome fit a neutral. model when several sites in the oral cavity were individually con. sidered source communities The goodness of fit R2 values were. 0 86 with oral wash 0 77 with tonsils 0 75 with throat and 0 73. with saliva as source communities where 0 is no fit and 1 is. perfect fit Fig 2A Eighty five to 95 of the sequences from. each of these sites fall within neutrally distributed OTUs in the. lungs Fig 3A Dental plaque and gingiva were the only sites in FIG 2 Results of neutral model testing with A tonsils B gingiva and C. female urogenital tract as potential source communities for microbes in the. the mouth that fit the neutral model poorly R2 0 06 and 0 18. lungs The coefficient of determination R2 is the goodness of fit of the neutral. respectively Fig 2B This finding is not unexpected because model It ranges from 0 no fit to 1 perfect fit Note the correspondence. microbes in these sites are predominantly in adherent biofilms between decreasing values of R2 from panels A to C and the proximity of points. 26 thus limiting their dispersal to the lungs Of particular note is to the line denoting the best fitting neutral model. the dental plaque because 36 of the sequences in plaque fall. within OTUs that are underrepresented in the lungs. When the anterior nares was considered a source community source of microbes for both the lungs and upper GI tract the. the neutral model failed to describe the composition of the lung upper GI tract should appear as a potential source of microbes for. microbiome R2 0 32 and most sequences from this site fall the lungs by the neutral model Indeed the neutral model per. within OTUs that are underrepresented in the lungs Fig 3A formed modestly well with the upper gastrointestinal tract as a. This result most likely reflects dispersal limitation of bacteria from source of the lung microbiome R2 0 42 Sixty nine percent. this habitat Bacteria from the anterior nares can be trapped in the of the sequences from this site fall within neutrally distributed. flowing mucus blanket covering the nasal mucosa deeper in the OTUs in the lungs Fig 3A Finally the neutral model failed. nose 27 and therefore never reach the lungs Indeed 36 of when other body sites such as the skin colon and urogenital. OTUs in the anterior nares are never detected in lung surveys tract were considered sources for the lungs Fig 2C and 3A Most. Microbes from the oral cavity are swallowed regularly into the sequences from these sites are underrepresented in the lungs. upper gastrointestinal GI tract Fig 1A Therefore samples ob Fig 3A. tained from the upper GI tract should represent microbes that are Next we determined if any OTUs consistently deviated from. readily dispersed from the oral cavity We tested this with the predictions of the neutral model i e they were always overrepre. neutral model by considering the oral cavity as a source of mi sented in the lungs irrespective of the source green symbols in. crobes for the upper GI tract Indeed the model fit was 0 54 and Fig 1B These would be the strongest candidates for microbes. 75 of the sequences from the oral cavity fell within neutrally that are adapted for growth in the lungs While no OTUs deviated. distributed OTUs in the upper GI tract Thus if the oral cavity is a consistently from predictions of the neutral model some OTUs. January February 2015 Volume 6 Issue 1 e02284 14,mbio asm org 3. Venkataraman et al, FIG 3 The neutral model applied to each body site as a potential source of microbes for the lung microbiome Shown are the abundance of neutrally distributed.
overrepresented and underrepresented OTUs in lungs from each body site and the associated goodness of fit of the neutral model R2. deviated from the neutral model more often than others and were. also present at a relative abundance of 0 5 in the lungs Fig 4. Conceptually we expect that the oral wash and saliva are com. posed of easily displaceable microbes compared to the buccal mu. cosa or tonsils and therefore are more representative of microbes. reaching the lungs However we did not find any OTUs that de. viated positively from the neutral model when both the oral wash. and saliva were considered source sites Fig 4, We also applied the neutral model to microbial communities. in diseased lungs For this we used upper source site and lower. target site respiratory tract microbial data from previously pub. lished studies on cystic fibrosis and idiopathic interstitial pneu. monia 28 29 In both cases the neutral model failed to describe. the composition of the lung microbiome Table 1, Sixty one percent of sequences in BAL samples cluster into. OTUs with readily culturable members Application of the neu. tral model suggests that the microbial DNA recovered from BAL. samples in healthy individuals is largely from microbes dispersing. from the oral cavity The lungs have multiple mechanisms in place. to kill bacteria 30 Therefore it is possible that these dispersed. FIG 4 List of OTUs that most commonly deviated from the neutral model. microbes are killed at the same rate as they are introduced into the and had a relative abundance of 0 5 in the lungs Green circles indicate the. lungs This would result in an impression of neutral distribu sites from which the OTU appeared as being overrepresented in the lungs and. tion when in fact the host is strongly selecting against all mi gray circles are the sites from which the OTU was neutrally distributed. mbio asm org January February 2015 Volume 6 Issue 1 e02284 14. The Lung Microbiome, TABLE 1 Results of neutral model applied to lungs of diseased patients. No of sequences of lung sequences,Patient group n in lung survey analyzed R2. Cystic fibrosis 9 a 52 050 54 OTUs 93 4 29 OTUs 0 86. Idiopathic 1 590 95 OTUs 89 9 48 OTUs 1 61,interstitial.
pneumonia 4 b,a Source site patients throats,b Source site patients oral washes. FIG 5 Cultivar taxonomy mapped onto the rank abundance curve of 16S. crobes and killing them To address this possibility we assessed rRNA encoding gene surveys of BAL samples Colored OTUs represent those. the viability of microbes in BAL samples by cultivation with a scored as having a cultured representative Open circles represent OTUs that. variety of media Table 2 and incubation conditions 21 O2 were not cultivated a list of uncultivated OTUs is provided in Table S1 in the. 2 O2 and 0 O2 Phylogenetic identity of the cultivars was supplemental material. assessed by plate wash PCR of the 16S rRNA encoding gene 31. The resulting sequences were analyzed along with culture. independent 16S rRNA encoding gene sequence surveys of BAL of microbes from the oral and nasal cavities We sought to deter. samples mine the relative importance of neutral versus selective processes. A total of 514 OTUs defined at 97 sequence similarity in shaping the healthy lung microbiome by using a neutral model. were observed in the culture independent surveys of BAL sam of community ecology The model was used as a null hypothesis. ples and 100 OTUs were identified in culture dependent surveys i to determine if dispersal from other body sites such as tonsils. We applied two criteria for comparing culture independent and and throat and ecological drift within the lungs are sufficient to. culture dependent surveys First we removed global singleton explain the observed composition of the lung microbiome and ii. sequences from both the culture independent and culture to identify bacterial species that deviated from the model expec. dependent surveys Next each OTU from the culture independent tations The composition of the healthy lung microbiome was. survey was scored as having a cultured representative if the same consistent with neutral model predictions when several sites in the. OTU was observed and contained at least 10 sequences in the plate oral cavity were considered source communities No bacterial spe. wash PCR samples Twenty seven OTUs fulfilled these criteria cies in the lungs were identified that consistently deviated from the. and these OTUs included 61 of the sequences from culture model expectations The neutral model explicitly incorporates. independent surveys Therefore viable and readily culturable bac ecological drift in addition to dispersal as a neutral process How. teria represent OTUs that comprise a majority of the sequences ever because of the recurrent microbial flux between the lungs. identified in lavage samples Delineating cultivars by the incuba and oral cavity we think that in this habitat dispersal is the more. tion oxygen conditions 19 of the 27 OTUs were represented by relevant neutral process Consequently we interpret our results as. cultivars from oxic or microoxic conditions and the remaining indicating that even if there is selective growth in the lungs its. 8 OTUs by cultivars unique to anoxic conditions The 19 oxic impact on community structure is overridden by the magnitude. and 8 anoxic OTUs respectively constitute 50 and 11 of the and frequency with which microbes are dispersed from the oral. sequences identified in culture independent surveys So even after cavity While application of the neutral model to individual vol. 2 years of storage at 80 C cultivars were readily obtained that unteers for which temporal samples of the upper and lower respi. clustered in OTUs encompassing 61 of the sequences in culture ratory tract were collected would be a more direct assessment of. independent surveys of BAL specimens Many of the prominent the role of dispersal versus selection it is difficult to justify such an. OTUs from surveys are represented by cultivars Fig 5 although intensive sampling regimen. cultivation did not capture representatives from some OTUs clas It is tempting to suggest that departure from a neutral distri. sified as Enterobacteriaceae Prevotella sp and Porphyromonas sp bution toward increased selection in the lungs is associated with. diseased states We tested this prediction by applying our imple. DISCUSSION mentation of the neutral model to diseased lungs using previously. Given the sparsity of microbes in healthy lungs the composition published data 28 29 The neutral model failed to describe the. of the lung microbiome is susceptible to being shaped by dispersal observed lung microbial community composition indicating ac. tive selection in these lungs Table 1 We speculate that the extent. TABLE 2 Description of media used in this studya of departure from neutrality will correlate with disease severity. i e a neutral distribution would prevail over selection in initial. Medium Targeted organism s stages and vice versa as disease progresses Consequently we pro. Tryptic soy agar Many heterotrophic bacteria pose that maintaining a neutral distribution of microbes in lungs. Mannitol salt agar Staphylococcus sp may be critical for host health To accomplish this further re. CDC kanamycin vancomycin Pigmented Prevotella spp, search needs to be focused on understanding the dynamics of this. laked blood agar some Porphyromonas spp, Mitis salivarius agar Streptococcus spp neutral distribution e g the kinetics of entry of microbes into the. Chocolate bacitracin agar Haemophilus spp Campylobacter spp lungs. and other Gram negative An alternate interpretation of our findings with the neutral. capnophiles model applied to healthy lungs is that the environmental condi. Enterococcosal agar Enterococcus spp tions in the oral cavity and lower respiratory tract are similar. a Described in reference 47 enough that species identified as neutrally distributed in the. January February 2015 Volume 6 Issue 1 e02284 14,mbio asm org 5. Venkataraman et al, lungs might experience the same levels of selection in both body ples using standard cultivation techniques Viable and readily cul.
sites The lower respiratory tract is indeed more similar to the oral turable bacteria represent OTUs that make up 61 of the. cavity than most other body sites but it is distinct in several pa sequences recovered from lavage samples Finally our implemen. rameters known to influence microbial growth including oxygen tation of the neutral model provides a general basis to discern the. tension pH blood perfusion temperature epithelial cell struc relative importance of dispersal and selection in diverse micro. ture composition of inflammatory cells and mucus layer thick biomes especially those where there is potential for continuous. ness 32 35 Furthermore the distal surface of the lungs is bathed dispersal of microbes from the surrounding environment. in surfactants which are selectively bacteriostatic 36 Therefore. we do not expect that the species from the oral cavity identified as MATERIALS AND METHODS. being neutrally distributed in the lungs result from similar selec To characterize the lung microbiome we used previously generated mo. tive regimens in these two habitats lecular surveys of the 16S rRNA encoding gene sequences v3 5 hyper. Studies of the lung microbiome typically require invasive sam variable region from bronchoalveolar lavages BAL performed on 62. pling by introducing a bronchoscope into the lungs through the healthy subjects 24 We also used 16S sequences generated from oral. upper respiratory tract During this procedure the bronchoscope wash samples from the same subjects 24 In order to apply the neutral. comes into contact with the microbiome of the mouth and upper model to other body sites such as tonsils and tongue as sources for the. lung microbiome we used sequences from phase I of the Human Micro. respiratory tract and there may be aspiration of upper respiratory. biome Project 43 44 This included several sites in the oral cavity ante. secretions and consequently carryover of microbes into the lungs rior nares skin gastroinstestinal GI tract and the female urogenital. This potential problem has been examined in several commentar tract from approximately 242 individuals These sequences had already. ies on the healthy lung microbiome 37 38 Charlson et al 39 been denoised as described by Ding and Schloss 44 Metadata associ. used a novel two scope method to control for this procedural ated with these sequences were obtained from dbGAP accession no. contamination and demonstrated that even after accounting for phs000228 v3 p1. this scope mediated carryover there was amplifiable microbial Collection of samples from the upper GI tract Since the oral cavity is. DNA in the lung In an independent study Dickson et al 40 connected to both the lungs and the upper GI tract microbes from the. reported that the collection of microbes in brochoalveolar lavage oral cavity can move to both these sites Fig 1A Therefore we investi. BAL specimens was not influenced by the route of broncho gated if there was any relationship between the upper GI tract and the lung. microbiomes Upper GI tract samples were collected from the same vol. scope insertion i e either through the mouth or nose even. unteers at University of Michigan whose lungs were sampled by Morris et. though these two sites harbor very distinct microbial communi al 24 The GI tract samples were obtained concomitantly with BAL fluid. ties This finding indicates that the BAL fluid microbiota is not specimens from these subjects Studies and consent procedures were per. exclusively a result of carryover of microbes during passage of the formed in accordance with the Declaration of Helsinki at the VA Ann. bronchoscope Additionally it provides validation that this col Arbor Healthcare System and were approved by its Institutional Review. lection of microbes represents the lower airway microbiome In Boards FWA 00000348 All subjects understood the purpose of the study. this study we accounted for equipment and reagent derived con and gave written consent before any research procedures All subjects. tamination and refer to the resulting collection of 16S rRNA underwent a complete history and physical examination by a pulmonolo. encoding gene sequences from BAL fluid surveys as the healthy gist complete pulmonary function testing including spirometry ple. thysmographic lung volumes and diffusing capacity posterior anterior. lung microbiome, and lateral chest radiographs prospective collection of medication his. After using the neutral model to suggest that dispersal over tory and complete blood count with differential coagulation studies and. rides selection in influencing the composition of the healthy lung a chemistry panel. microbiome we assessed the viability of these dispersed microbes Sample collection was performed under moderate conscious sedation. using standard cultivation techniques from BAL samples We intravenous diphenhydramine midazolam and fentanyl by a single. found that viable and readily culturable bacteria grouped into bronchoscopist Subjects received topical anesthesia 4 lidocaine by. OTUs that contained 61 of the sequences identified in lavage nebulizer and atomizer spray to the posterior oropharynx and then 4. samples Our estimate of the viable population could be conser lidocaine in four 1 ml aliquots instilled directly onto the vocal cords. vative because of i the limited number of culture conditions Subglottic lidocaine and suctioning were minimized to avoid contamina. used ii loss of viability during storage and iii the fact that tion of samples The patient s head was flexed and an 18G gastric tube as. introduced via the mouth observed to pass posterior to the larynx into the. microbes can exist in a viable but nonculturable state and still play. esophagus and advanced to 35 cm from the mouth Correct placement of. important roles in vivo e g Pneumocystis jirovecii in lungs 41 the gastric tube was confirmed by auscultation of air introduced using a. 42 While the potential impact of the lung microbiome on the Toomey syringe Fifty milliliters of normal saline was instilled and imme. host is yet to be delineated we show that a large proportion of the diately withdrawn using manual suction The gastric return was collected. microbial DNA derived from BAL samples can originate from in sterile specimen cups which were placed on ice until transported from. viable microbes the bronchoscopy suite to the laboratory where they were immediately. Conclusions This study addresses two key issues regarding the processed. healthy lung microbiome First we addressed the relative contri DNA extraction from upper GI tract samples Samples were trans. bution of neutral and selective processes in shaping the lung mi ferred to the laboratory on ice and 1 ml was transferred to a dry bead tube. Mo Bio Ultra clean fecal DNA Isolation kit catalog no 12811 100 DBT. crobiome Using the neutral model our data suggest that dispersal. The tubes were then centrifuged for 2 min at 16 000 g and the super. of microbes from the oral cavity is the primary driver of the com natant fraction was removed This process was repeated until 10 ml of. position of the healthy lung microbiome No species were identi gastric contents had been transferred to the dry bead tube Samples were. fied that consistently deviated from the neutral model predictions then stored at 80 C until DNA isolation Seven hundred fifty microli. suggesting that constant dispersal overrides selection in this hab ters of PowerSoil DNA kit bead solution Mo Bio catalog no 12855 50. itat Second we determined the viability of bacteria in BAL sam BS and 60 l of PowerSoil DNA kit solution C1 were added to each dry. mbio asm org January February 2015 Volume 6 Issue 1 e02284 14. The Lung Microbiome, bead tube containing pellet from 10 ml of gastric contents Samples were probability of detecting. bead beaten for 2 min on the homogenize setting of a Mini. microbe in lungs, BeadBeater 8 BioSpec Products and centrifuged for 30 s at 10 000 g abundance of that microbe. because of continued, We then continued with the PowerSoil DNA isolation kit protocol Mo in that body site. dispersal from another, Bio catalog no 12888 starting with step 7 transfer of supernatant to a.
clean 2 ml collection tube or samples were transferred into a 1 ml col body site and ecological drift. lection plate to continue with the PowerSoil htp 96 well soil DNA isola Simplistically high abundance in the source site would result in a. tion kit protocol Mo Bio catalog no 12955 starting with step 10 addi greater probability of detection in the lungs because of continued disper. tion of 250 l solution C2 to each well on an epMotion 5075 Eppendorf sal and the converse with low abundance In this implementation of the. or Biomek FXP Beckman Coulter Libraries of 16S rRNA gene ampli neutral model the source community was created by pooling surveys of. cons v3 5 hypervariable region were constructed based on the HMP the same body site from multiple individuals e g the throat microbial. Consortium protocol http www hmpdacc org doc 16S Sequencing community from multiple individuals The relative abundance of a given. OTU in the source community was calculated as no of sequences with. SOP 4 2 2 pdf with the modifications described below Each 20 l PCR. OTU in source community total no of sequences in source community. mixture contained 2 l Accuprime PCR buffer II Life Technologies. Similarly the empirically observed frequency of detection for each OTU. 0 15 l Accuprime high fidelity Taq DNA polymerase Life Technolo. in the lungs was calculated as no of individuals in whose lungs OTU was. gies 0 2 M primer A CCATCTCATCCCTGCGTGTCTCCGACTCA detected total no of individuals whose lungs were surveyed. GXXXXXCCGTCAATTCMTTTRAGT 0 2 M primer B CCTATCCC Next for each OTU shared between the lung and the source commu. CTGTGTGCCTTGGCAGTCTCAGCCTACGGGAGGCAGCAG and nity a beta probability distribution was used to calculate the expected. 1 l DNA The boldface portions of primer A and primer B are 926R and frequency of detection in the lungs if it was present via dispersal and. 357F respectively The region of primer A represented by XXXXX is the 5 ecological drift 18 Briefly the lower limit of this probability density. to 10 nucleotide bar code sequence The remainders of primer A and function is the relative abundance of the least abundant OTU in the source. primer B are the A adapter sequence and the B adapter sequence respec community while the upper limit is 1 The shape parameters for the. tively required for emulsion based clonal amplification PCR emPCR probability distribution were determined by an overall fitting parameter. and 454 sequencing PCR started with 2 min at 95 C followed by 20 cycles Ntm and the relative abundance of the OTU in the source community. of touchdown PCR with 20 s at 95 C and 30 s at the annealing tempera The fitting parameter reflects the dispersal of microbes from the source. ture which was 60 C in the first cycle and dropped 0 5 C with each cycle community to the lungs The value of this parameter was optimized using. with 5 min at 72 C and then 20 cycles of standard PCR with 20 s at 95 C a least squares approach such that the sum of squares of residuals is min. 30 s at 50 C and 5 min at 72 C PCR products were purified with AMPure imized. XP Agencourt according to the manufacturer s instructions except Ntm. 0 6 the amplicon volume 10 8 l of beads was used rather than 1 2 in total no of OTUs. order to remove more of the small products The purified PCR products minimize observed detection frequency for OTUi. were quantified with a Quant iT PicoGreen double stranded DNA ds i 1. DNA kit Invitrogen according to the manufacturer s instructions and. combined into a pool with equal amounts of each amplicon To accom predicted detection frequency for OTUi 2. modate all of the samples three pools were made Each pool was then Finally the variability around this expected detection frequency was. purified with AMPure XP Agencourt according to the manufacturer s calculated using 95 binomial proportion confidence intervals Wilson. instructions except the volume of beads was 0 6 the pool volume The method 46 with the HMisc package in R Calculating this for all OTUs. pools were quantified with a Library Quantification kit for Roche 454 GS yields the best fit neutral model curve and the 95 confidence intervals. Titanium KAPA Large volume Lib L emPCRs Roche 454 were per shown in Fig 1B The goodness of fit of this curve was assessed using the. formed and 454 sequencing was done using the GS FLX Titanium plat coefficient of determination R2 OTUs that fall within the confidence. form Roche according to the manufacturer s instructions intervals imposed around the best fit neutral model curve are consistent. Sequence curation All sequences were curated using mothur v1 31 2 with random dispersal and ecological drift i e neutrally distributed. 45 The low biomass associated with lung samples raised the possibility gray points in Fig 1B OTUs that fall above the upper bound of the. of reagent derived and equipment derived DNA contamination of sam confidence interval are disproportionately overrepresented in the lungs. ples Three kinds of controls were collected and sequenced to address compared to those predicted by their abundance in the source green. these possibilities i sterile saline in a sample collection cup obtained at points in Fig 1B These OTUs are the strongest candidates for either. the time of specimen collection ii sterile saline washed through the having a competitive advantage in the lungs or increased dispersal ability. bronchoscope just prior to bronchoscopy as a control for DNA in the relative to other microbes from the source site Similarly OTUs falling. scope and iii DNA from the reagents used for extraction 24 The below the lower bound of the confidence interval are disproportionately. neutral model was used to identify sequences that were likely present in underrepresented in the lungs compared to those predicted by their abun. dance in the source This suggests either a disadvantage to these OTUs in. the lung samples due to contamination from these controls see Neutral. the lungs or a dispersal limitation from the source site red points in. model analyses below These putative contaminant sequences were re. Fig 1B Finally the cumulative relative abundances of these three cate. moved from 16S libraries derived from lung samples The resulting data. gories of OTUs were used as a metric to evaluate the contributions of. set was subsampled to 500 sequences per sample and clustered into OTUs random dispersal and ecological drift abundance of gray OTUs in. at 97 sequence similarity At this subsampling depth the Good s cover source community and selection abundance of green and red OTUs. age for all samples was greater than 95 suggesting that the subsample in source community from that source community in shaping the com. size was reasonable position of the lung microbiome. Neutral model analyses To determine the relative importance of neu In order to identify putative contaminant sequences in lung samples. tral processes i e dispersal and ecological drift and selection in the from equipment and from reagent derived DNA the neutral model was. healthy lung microbiome we implemented our version of the neutral applied using the sequences recovered from the three types of controls. model using custom scripts in the R language Several body sites such as pooled to create the source community This analysis was performed prior. the mouth and tonsils were considered sources for the lung microbiome to clustering the sequences into OTUs at 97 similarity Sequences falling. The mathematical premise of our neutral model is as follows within the confidence intervals of the model neutrally distributed from. January February 2015 Volume 6 Issue 1 e02284 14,mbio asm org 7. Venkataraman et al, controls gray points in Fig 1B and outside the lower bounds of the REFERENCES. confidence intervals enriched in controls red points in Fig 1B were 1 Huang YJ Charlson ES Collman RG Colombini Hatch S Martinez. considered to be contaminating sequences and were removed from anal FD Senior RM 2013 The role of the lung microbiome in health and. ysis of all BAL samples Only sequences falling outside the upper bounds disease A National Heart Lung and Blood Institute workshop report Am. of the confidence interval with the controls as the source selected for in J Respir Crit Care Med 187 1382 1387 http dx doi org 10 1164. BAL samples green points in Fig 1B and unique to BAL specimens not rccm 201303 0488WS. detected in controls were retained for downstream analyses 2 Charlson ES Bittinger K Haas AR Fitzgerald AS Frank I Yadav A. Cultivation of microbes from BAL fluid To assess whether the DNA Bushman FD Collman RG 2011 Topographical continuity of bacterial. recovered from lavage fluid samples originated from viable microbes we populations in the healthy human respiratory tract Am J Respir Crit Care. cultivated microbes from these BAL samples Three milliliter aliquots of Med 184 957 963 http dx doi org 10 1164 rccm 201104 0655OC. 3 Segal LN Alekseyenko AV Clemente JC Kulkarni R Wu B Gao Z. BAL fluid stored frozen at 80 C with 5 dimethyl sulfoxide as a cryo. Chen H Berger KI Goldring RM Rom WN Blaser MJ Weiden MD. protectant were used as inocula for cultivation The samples were thawed. 2013 Enrichment of lung microbiome with supraglottic taxa is associated. at 4 C vortexed for 30 s and then centrifuged at 7 068 g for 10 min The with increased pulmonary inflammation Microbiome 1 2049 2619. supernatant fraction was discarded and the cell pellet was resuspended in http dx doi org 10 1186 2049 2618 1 19. 240 l Hanks balanced salt solution Gibco Life Technologies followed 4 Charlson ES Diamond JM Bittinger K Fitzgerald AS Yadav A Haas. by plating of 10 l directly on six different media tryptic soy agar man AR Bushman FD Collman RG 2012 Lung enriched organisms and. nitol salt agar CDC kanamycin vancomycin laked blood agar mitis sali aberrant bacterial and fungal respiratory microbiota after lung transplant. varius agar chocolate bacitracin agar and enterococcosal agar BD Am J Respir Crit Care Med 186 536 545 http dx doi org 10 1164. Difco These media were chosen based upon the taxonomic classification rccm 201204 0693OC. of 16S sequences recovered directly from BAL samples Since the lungs are 5 Sze MA Dimitriu PA Hayashi S Elliott WM McDonough JE Gos. heterogeneous with respect to oxygen concentration plates were incu selink JV Cooper J Sin DD Mohn WW Hogg JC 2012 The lung tissue. bated at 37 C for 7 days in oxic 5 CO2 21 O2 balance N2 hypoxic microbiome in chronic obstructive pulmonary disease Am J Respir Crit. Care Med 185 1073 1080 http dx doi org 10 1164 rccm 201111. 5 CO2 2 O2 balance N2 or anoxic 5 CO2 5 H2 balance N2. atmospheres BAL samples from 38 individuals were used for cultivation. 6 Jonathan M Chase MAL 2003 Ecological niches linking classical and. So that the identity of cultivars could be compared with the culture contemporary approaches University of Chicago Press Chicago IL. independent surveys from BAL samples we performed plate wash PCR 7 Hutchinson GE 1957 Concluding remarks Cold Spring Harb Symp. 31 After 7 days of incubation the surface of plates was flooded with 1 to Quant Biol 22 415 427 http dx doi org 10 1101 SQB 1957 022 01 039. 2 ml of sterile tryptic soy broth TSB and a sterile spreader was used to 8 Wennekes PL Rosindell J Etienne RS 2012 The neutral niche debate. suspend as much colony material as possible DNA was extracted from a philosophical perspective Acta Biotheor 60 257 271 http dx doi org. 500 l of this solution using the Mo Bio PowerSoil DNA extraction kit 10 1007 s10441 012 9144 6. Amplification of the v3 5 region of the 16S rRNA encoding gene was 9 Hutchinson GE 1959 Homage to Santa Rosalia or why are there so many. accomplished using the Broad HMP protocol http hmpdacc org doc kind of animals Am Nat 93 145 159 http dx doi org 10 1086 282070. 16S Sequencing SOP 4 2 2 pdf The PCR products were sequenced on 10 Hubbell SP 2001 The unified neutral theory of biodiversity and bioge. the Roche 454 GS Junior titanium platform according to the manufactur ography p 29 Princeton University Press Princeton NJ. 11 Hamdan LJ Coffin RB Sikaroodi M Greinert J Treude T Gillevet PM. er s instructions, 2013 Ocean currents shape the microbiome of Arctic marine sediments. Nucleotide sequence accession number The 16S rRNA encoding ISME J 7 685 696 http dx doi org 10 1038 ismej 2012 143. gene sequences from the upper GI tract samples have been deposited in 12 Wilkins D van Sebille E Rintoul SR Lauro FM Cavicchioli R 2013. GenBank BioProject ID no PRJNA263948 Advection shapes Southern Ocean microbial assemblages independent of. distance and environment effects Nat Commun 4 2457 http. SUPPLEMENTAL MATERIAL dx doi org 10 1038 ncomms3457. 13 Szekely AJ Berga M Langenheder S 2013 Mechanisms determining the. Supplemental material for this article may be found at http mbio asm org. fate of dispersed bacterial communities in new environments ISME J. lookup suppl doi 10 1128 mBio 02284 14 DCSupplemental. 7 61 71 http dx doi org 10 1038 ismej 2012 80,Table S1 XLSX file 0 04 MB. 14 Whitaker RJ Grogan DW Taylor JW 2003 Geographic barriers isolate. endemic populations of hyperthermophilic archaea Science 301. ACKNOWLEDGMENTS 976 978 http dx doi org 10 1126 science 1086909. A V is supported by a T32 HL007749 fellowship Multidisciplinary 15 Lankau EW Hong PY Mackie RI 2012 Ecological drift and local expo. sures drive enteric bacterial community differences within species of Gala. Training Program in Lung Disease This work was supported by National. pagos iguanas Mol Ecol 21 1779 1788 http dx doi org 10 1111 j 1365. Institutes of Health grants R01 0099549 to T M S and R01 HL114447 to 294X 2012 05502 x. G B H The Lung HIV Microbiome Project LHMP consortium funded 16 Ofit eru ID Lunn M Curtis TP Wells GF Criddle CS Francis CA. by U01 HL098961 J M B V B Y and J L C also provided support for Sloan WT 2010 Combined niche and neutral effects in a microbial waste. this project water treatment community Proc Natl Acad Sci U S A 107 15345 15350. We acknowledge William T Sloan University of Glasgow for making http dx doi org 10 1073 pnas 1000604107. their version of the neutral model available and valuable discussions re 17 Zhou J Liu W Deng Y Jiang Y H Xue K He Z Van Nostard J Wu. garding its adaptation for our purposes We also thank Annette Marie L Yang Y Wang A 2013 Stochastic assembly leads to alternative com. Ostling University of Michigan Ann Arbor for thoughtful inputs re munities with distinct functions in a bioreactor microbial community. garding the neutral biodiversity theory and neutral model We acknowl mBio 4 2 e00584 12 http dx doi org 10 1128 mBio 00584 12. edge Brendan Bohannan and Adam Burns University of Oregon for 18 Sloan WT Lunn M Woodcock S Head IM Nee S Curtis TP 2006. providing valuable feedback on the manuscript and proposing the Quantifying the roles of immigration and chance in shaping prokaryote. community structure Environ Microbiol 8 732 740 http dx doi org. goodness of fit measure Pradeep Singh University of Washington pro. 10 1111 j 1462 2920 2005 00956 x, vided sequences from cystic fibrosis patients and useful discussions re 19 Hubbell SP 2005 Neutral theory in community ecology and the hypoth.
garding the interpretations of our results Markus Hilty Insitute of Infec esis of functional equivalence Funct Ecol 19 166 172 http dx doi org. tious Diseases Bern Switzerland provided sequences from patients with 10 1111 j 0269 8463 2005 00965 x. idiopathic interstitial pneumonia Finally we thank Michael Cox Na 20 Leigh EG Jr 2007 Neutral theory a historical perspective J Evol Biol. tional Heart and Lung Institute London United Kingdom for com 20 2075 2091 http dx doi org 10 1111 j 1420 9101 2007 01410 x. ments on the manuscript 21 Rosindell J Hubbell SP He F Harmon LJ Etienne RS 2012 The case. mbio asm org January February 2015 Volume 6 Issue 1 e02284 14. The Lung Microbiome, for ecological neutral theory Trends Ecol Evol 27 203 208 http ogy of the lung new conceptual models of pulmonary microbiology and. dx doi org 10 1016 j tree 2012 01 004 pneumonia pathogenesis Lancet Respir Med 2 238 246 http. 22 Gilbert B Laurance WF Leigh EG Jr Nascimento HE 2006 Can dx doi org 10 1016 S2213 2600 14 70028 1. neutral theory predict the responses of Amazonian tree communities to 35 Hatch TF 1961 Distribution and deposition of inhaled particles in respi. forest fragmentation Am Nat 168 304 317 http dx doi org 10 1086 ratory tract Bacteriol Rev 25 237 240. 506969 36 Wu H Kuzmenko A Wan S Schaffer L Weiss A Fisher JH Kim KS. 23 Adler PB HilleRisLambers J Levine JM 2007 A niche for neutrality McCormack FX 2003 Surfactant proteins A and D inhibit the growth of. Ecol Lett 10 95 104 http dx doi org 10 1111 j 1461 0248 2006 00996 x Gram negative bacteria by increasing membrane permeability J Clin In. 24 Morris A Beck JM Schloss PD Campbell TB Crothers K Curtis JL vest 111 1589 1602 http dx doi org 10 1172 JCI16889. Flores SC Fontenot AP Ghedin E Huang L Jablonski K Kleerup E 37 Segal LN Blaser MJ 2014 A brave new world the lung microbiota in an. Lynch SV Sodergren E Twigg H Young VB Bassis CM Venkataraman era of change Ann Am Thorac Soc 11 S21 S27 http dx doi org. A Schmidt TM Weinstock GM 2013 Comparison of the respiratory 10 1513 AnnalsATS 201306 189MG. microbiome in healthy nonsmokers and smokers Am J Respir Crit Care 38 Berger G Wunderink RG 2013 Lung microbiota genuine or artifact Isr. Med 187 1067 1075 http dx doi org 10 1164 rccm 201210 1913OC Med Assoc J 15 731 733. 25 Colin A Windmeijer FAG 1997 An R squared measure of goodness of 39 Charlson ES Bittinger K Chen J Diamond JM Li H Collman RG. fit for some common nonlinear regression models J Econ 77 329 342 Bushman FD 2012 Assessing bacterial populations in the lung by repli. http dx doi org 10 1016 S0304 4076 96 01818 0 cate analysis of samples from the upper and lower respiratory tracts PLoS. 26 Valm AM Mark JL Rieken CW Hasegawa Y Sogin ML Oldenbourg One 7 e42786 http dx doi org 10 1371 journal pone 0042786. R Dewhirst FE Borisy GG 2011 Systems level analysis of microbial 40 Dickson RP Erb Downward JR Freeman CM Walker N Scales BS. community organization through combinatorial labeling and spectral im Beck JM Martinez FJ Curtis JL Lama VN Huffnagle GB 2014. aging Proc Natl Acad Sci U S A 108 4152 4157 http dx doi org Changes in the lung microbiome following lung transplantation include. 10 1073 pnas 1101134108 the emergence of two distinct Pseudomonas species with distinct clinical. 27 Cohen NA 2006 Sinonasal mucociliary clearance in health and disease associations PLoS One 9 e97214 http dx doi org 10 1371. Ann Otol Rhinol Laryngol Suppl 196 20 26 journal pone 0097214. 28 Goddard AF Staudinger BJ Dowd SE Joshi Datar A Wolcott RD 41 Huang L Cattamanchi A Davis JL den Boon S Kovacs J Meshnick S. Aitken ML Fligner CL Singh PK 2012 Direct sampling of cystic fibrosis Miller RF Walzer PD Worodria W Masur H International HIV. lungs indicates that DNA based analyses of upper airway specimens can Associated Opportunistic Pneumonias IHOP Study Lung HIV Study. misrepresent lung microbiota Proc Natl Acad Sci U S A 109 2011 HIV associated Pneumocystis pneumoniae Proc Am Thorac Soc. 13769 13774 http dx doi org 10 1073 pnas 1107435109 8 294 300 http dx doi org 10 1513 pats 201009 062WR. 29 Garzoni C Brugger SD Qi W Wasmer S Cusini A Dumont P 42 Oliver JD 2010 Recent findings on the viable but nonculturable state in. Gorgievski Hrisoho M M hlemann K von Garnier C Hilty M 2013 pathogenic bacteria FEMS Microbiol Rev 34 415 425 http dx doi org. Microbial communities in the respiratory tract of patients with interstitial 10 1111 j 1574 6976 2009 00200 x. lung disease Thorax 68 1150 1156 http dx doi org 10 1136 thoraxjnl 43 Human Microbiome Project Consortium 2012 Structure function and. 2012 202917 diversity of the healthy human microbiome Nature 486 207 214 http. 30 Pezzulo AA Kelly PH Nassar BS Rutland CJ Gansemer ND Dohrn dx doi org 10 1038 nature11234. CL Costello AJ Stoltz DA Zabner J 2013 Abundant DNase I sensitive 44 Ding T Schloss PD 2014 Dynamics and associations of microbial com. bacterial DNA in healthy porcine lungs and its implications for the lung munity types across the human body Nature 509 357 360 http. microbiome Appl Environ Microbiol 79 5936 5941 http dx doi org dx doi org 10 1038 nature13178. 10 1128 AEM 01752 13 45 Schloss PD Westcott SL Ryabin T Hall JR Hartmann M Hollister EB. 31 Stevenson BS Eichorst SA Wertz JT Schmidt TM Breznak JA 2004 Lesniewski RA Oakley BB Parks DH Robinson CJ Sahl JW Stres B. New strategies for cultivation and detection of previously uncultured mi Thallinger GG Van Horn DJ Weber CF 2009 Introducing mothur. crobes Appl Environ Microbiol 70 4748 4755 http dx doi org open source platform independent community supported software for. 10 1128 AEM 70 8 4748 4755 2004 describing and comparing microbial communities Appl Environ Micro. 32 Ingenito EP Solway J McFadden ER Jr Pichurko B Bowman HF biol 75 7537 7541 http dx doi org 10 1128 AEM 01541 09. Michaels D Drazen JM 1987 Indirect assessment of mucosal surface 46 Wilson EB 1927 Probable inference the law of succession and statistical. temperatures in the airways theory and tests J Appl Physiol 63 inference J Am Stat Assoc 22 209 212 http dx doi org 10 1080. 2075 2083 01621459 1927 10502953, 33 West JB 1968 Regional differences in the lung Postgrad Med J 44 47 Jousimies Somer H Summanen P Citron D Baron E Wexler H. 120 122 http dx doi org 10 1136 pgmj 44 507 120 Finegold S 2002 Wadsworth Ktl anaerobic bacteriology manual Star. 34 Dickson RP Erb Downward JR Huffnagle GB 2014 Towards an ecol Publishing Company Belmont CA. January February 2015 Volume 6 Issue 1 e02284 14,mbio asm org 9.


Related Books

ERP Product/Project Lifecycle Management

ERP Product Project Lifecycle Management

iff Davis / Comparison Guide / ERP Product/Project Lifecycle Management Comparison Guide iff Davis 2016 5 ERP Product/Project Lifecycle Management (continued) Vendor: Product Solution Work Order Management Project Management Job Management Planning & Scheduling Quality Assurance Infor LN Yes Infor Syteline Yes Epicore ERP Yes

Introduction to Microsoft Dynamics AX2012 for Public ...

Introduction to Microsoft Dynamics AX2012 for Public

Teri is a Microsoft Dynamics AX Solution Architect with over 20 years experience in the ERP implementation space and specializes in providing @g y leading-edge, information technology solutions to clients on a variety of platforms, including Microsoft Dynamics AX. She focuses on understanding client

Virtual Meeting Room (VMR) - VNOC Symphony

Virtual Meeting Room VMR VNOC Symphony

Business Use Only Visit go/vmr Novartis Business Services Virtual Meeting Room (VMR) Global Video Conferencing Service User Manual | For Non-Novartis External ...

Second Avenue Subway Phase 1 Project Monthly Report ...

Second Avenue Subway Phase 1 Project Monthly Report

PMOC MONTHLY REPORT Second Avenue Subway Phase 1 (MTACC-SAS) Project Metropolitan Transportation Authority New York, New York March 1 to March 31, 2012 . PMOC Contract No. DTFT60-09-D-00007 . Task Order No. 2, Project No. DC-27-5115, Work Order No. 02 . Urban Engineers of New York, P.C., 2 Penn Plaza, Suite 1103, New York, New York 10121

J&J Conferencing Services Frequently Asked Questions

J amp J Conferencing Services Frequently Asked Questions

Rev. August 2016 Page 3 J&J Conferencing Services BT MeetMe audio conferencing What information should I give to someone invited to my conference?

Annual report 2015 - Hanze

Annual report 2015 Hanze

- Keuzegids HBO 2016 23. Top degree programmes Keuzegids HBO 2016 (5 . entrepreneurship companies 22 2015 . Development. Groningen- ...

naTia montgomeri levan Wyonia giorgi jijavaZe saba maxaraSvili

naTia montgomeri levan Wyonia giorgi jijavaZe saba maxaraSvili

ganaTleba, eleqtronuli wignebi, TamaSebi da mravali sxva. Tanamedrove teqnologiebma saSualeba mogvca, Cveni cxovreba komfortulad vmarToT. komunikacia swrafi da efeqturi gaxda. dRes saSualeba gvaqvs nebismieri nivTi `onlain reJimSi~ SevisyidoT _ saqarTvelodan sxva kontinentze megobrebs gastronomiuli sursaTi an yvavilebi Cveni

As of CRS# SEC COURSE TITLE INSTRUCTOR REQUIRED 8.28.17 ...

As of CRS SEC COURSE TITLE INSTRUCTOR REQUIRED 8 28 17

EDITION 13TH 2017 MCG ... HED-100 M/T/Z Personal & Family Health STAFF TEXT $154.50 9780078028670 INSEL CONNECT CORE CONCEPTS IN HEALTH: BRIEF (LOOSE PGS) 14TH 2016 MCG ENG-105 A Speech Fundamentals DORR, SUMMER 2 TEXTS ENG-112 A Literature Appreciation: Special Topic -Sports FILLER, SHIR 4 TEXTS ENG100 A/B Ess Effective Writing DORR, SUMMER 2 TEXTS. FA17 TRI-CAMPUS BOOKLIST 8.28.17 ** TEXT ..

As of CRS# SEC COURSE TITLE INSTRUCTOR REQUIRED 5.16.17 ...

As of CRS SEC COURSE TITLE INSTRUCTOR REQUIRED 5 16 17

human anatomy & physiology 13th edition 13th 2017 mcg ... hed-100 m/t/z personal & family health staff text $154.50 9780078028670 insel connect core concepts in health: brief (loose pgs) 14th 2016 mcg hed-102 a intro nutrition steen, susan bundle $163.50 9780134560755 thompson nutrition for life (w/mastering nutrition & diet gdlns update & vp access code card) includes isbns 978013

Total Special Education System (TSES) - scred.k12.mn.us

Total Special Education System TSES scred k12 mn us

This document serves as the Total Special Education System Plan for the TRIO Wolf Creek Distance Learning Charter School in accordance with Minnesota Rule 3525.1100. The charter school is a member of the St. Croix River Education District (SCRED) through its contract with the Chisago Lakes School District and thus there will be reference to SCRED throughout the TSES.